Help needed for MySQL

software development

#1

hi guys, im really really new in this business… I dont know a thing abt mysql and some of the same stuff. i currently working as a research assistant at a genomics lab. i dunno if any of you guys ever heard of bioinformatics but that is what i am ‘playing’ with now. so, my supervisor asked me to make a searchable database using PHP and mysql… i have to learn all this stuff by myself…and so i did!but not all…just enuff to start building my own db…
my problem is… i dunno how to import a large compiled data (flat file format if im not mistaken)into my mysql database…
please take note that i didnt use command prompt to build my mysql databse so i dont know a thing of any of mysql command lines! I used a program named PHPTriad. Any of u guys heard this progrm b4? This prgrm contains all elements needed to start a mysql database - apache server, PHP and mysqladmin…all you have to do is to just install it to your PC and youre done!
just run the apache server, start the mysqladmin, and start building your mysql database… it’s quite user friendly…
If you guys happen to know or even better, have used this program b4(phptriad), please…please tell me more…

As for now, i am still inputing my data one by one into the db… and i have like, more than 1000 data files left!please help…thanks

I am a BEGINNER! Please hELpppp!!!


#2

Maybe if you showed us what format the datafile is in i.e. and example of it… someone could write a script or point you in the right direction.

Also you could include the layout of your database., which fields you have and where…


#3

the datafile is in ‘fasta’ format, but you use notepad to view them
here is one example of the datafile viewed on notepad:

[quote]CONTIG1 1 members, constructed from BG466330
[/quote]

AGCATTTAAAGAAATAAAAGGAGTTTTTTTTTCAGATTTACCTTTAGAGTGGCCGCTGCA
GCACCAGCAGCGGCAGCAGCACAGCAGCAGCAGCATCAGGGTTTATTTCACGCGAGGAGC

[quote]CONTIG2 1 members, constructed from AI676591
[/quote]

GGGAATAGAAGCTGCTATTTGCACAGGCGCGTGTGTTAATTCAATCCAGCATGGGCACCG
AGCATGTGCTCTAGCATCATTATGAGGTAGCATGGTGAATGGCGACAGTTTGGCGTGTGG

The datafiles are somewhat ‘stacked’ together. shown here are two of them…but there’s more…like thousands!
the ‘>’ symbol tells you that it is the beginning of each data.
the sentence after the ‘>’ for eg :
(CONTIG2 1 members, constructed from AI676591)
and those (CGATTTAGATAGCCT…) letters are the fields of the data. (field # 1 and 2 are separated by comma ‘,’ whereas field # 3 are placed on the second line after the first two field.

then comes the next part, the database! to build this database, i simply just install PHPTriad into my PC. I got this program, which is free :slight_smile: from PHPGeek.com
My PHPTriad is ver2.11 for windows. Then, i run the APACHE server which is bundled inside the triad program.(The prgrm contains MySQL, Apache server and PHP). Next, i run the winmysqladmin from C:\apache\mysql\bin and start standalone mysql server.
after that, i open a web browser and type <localhost/phpmyadmin/index.htm> on the address bar.The database interface will appear. Then. all i have to do is to just enter the databse name that i want to create and click on ‘create’ button. Basically, these program use web interface and you dont have to use the command prompt almost at all!
Just point, click and sometimes, type.

Then, what i did next is to create the tables and fields inside the tables and start inputting the data. The field names are the same in each table. i named the first table as : ID
second field : Accession #
third field : Sequences

As for now, what i did was to view the datafiles using notepad, select the fields (one by one!), copy the field,
then go to the database interface, select the table i need and paste the field into the table. (the table has a form-like interface)…

i wanted to just find out a way of how to dump all the datafiles into the database without select-copy-paste the datafiles one-by-one… would you guys please help me…
i’ll give more infos abt my databse when i knew the way of explaining it to you.:)(did i tell u i’m new in this business?)
Thanks guys!

I am a BEGINNER! Please hELpppp!!!


#4

I have only used PHPmyadmin as an interface with mySQL. Dreamhost now includes a version with all sites, so you don’t even need to install it. From the “Goodies” menu of the admin panel select mySQL, then click on your database name, and it will take you right to PHPmyadmin.

From here you can import whole files into your database. First click on the table name in the upper left hand corner, then scroll to the bottom of the screen. There is a link for inserting data from a file.

You may be able to insert the whole file just as it is. You will need to select the “>” as the field seperator. I have used this feature a number of times, it works really well, and can save a lot of time.

Good Luck,

Jeff
www.walltowallstencils.com


#5

another thing, i havent put the database online yet. i only run it from localhost. it’s just like a trial version of the db, that is to try and run it standalone first.

Jeff, do i have to run the apache server and/or mysql server first before going to GOODIES>mysql>mydatabase to be directed to phpmyadmin?
Are you saying that Dreamhost can detect where my PHPmyadmin is and take me right to it?
Anyway, i’ll try your advice… Thanks very much man!

I am a BEGINNER! Please hELpppp!!!


#6

nope, tried it… didnt work…
Here’s what i did,i follow exactly what you told me.
-I click on “goodies” tab
-then i click mysql
-then what i got was some empty space on screen. The tab menus and Dreamhost banner are still there but nothing in the center of the screen. i cant find where my database name is neither to be directed to phpmyadmin… i think i’m lost in space, literally… what shud i do?

I am a BEGINNER! Please hELpppp!!!


#7

I suppose everyone has there own way to develop new projects, and maybe it would be cool to hear some of those methods right here.

I personally just go ahead and build things live on line. I simply keep them seperate from pages our clients can get to. Like right now, I have added a few tables to our database, to add options to our products. I created a test product, with a name no one but myself will ever search for. Then I worked live on line to make everything right. Once done, I am certain it will work for everyone else.

That said, I’m not sure I can help you with a local database. I do know that I have entered hundreds of lines of code through PHPmyAdmin on Dreamhost.

At a different job, I have loaded thousands of lines of code to databases, with simple computer manipulations to all the lines simultaneously. I would NEVER retype individual fields, or enter them one at a time.

Jeff
www.walltowallstencils.com